Step 1.1 - Please enter your sequences in FASTA - format or upload a FASTA-file from your computer.
The FASTA header must contain a sequence name and a class label. The class label is specified with class (A) where A can be any class label.
Optionally, you can specify a subsequence (for example a protein binding site within an entire promotor sequence) with site(a,b) where a and b gives the location assumed the sequence starts by position 1. If no site(a,b) is given, the whole sequence is considered. To specify subsequences on the antisense strand, a should be greater than b (e.g. site(20,10)).
NOTE: The site label allows to use relative positions in the feature generation step (step 2).
The position a is considered to be 1. That means the interval -5 to -1 refers the 5 nuleotides upstream of the specified subsequence.
Example
>Sequence1 site(10,15) class(A)
tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttca
>Sequence2 site(15,25) class(B)
aggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctg
>Sequence2 site(15,10) class(A)
caactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgg