Step 1.1 - Please enter your sequences in FASTA - format or upload a FASTA-file from your computer.
The FASTA header must contain a sequence name and a class label. The class label is specified with class (A) where A can be any class label.
Optionally, you can specify a subsequence (for example a protein binding site within an entire promotor sequence) with site(a,b) where a and b gives the location assumed the sequence starts by position 1. If no site(a,b) is given, the whole sequence is considered. To specify subsequences on the antisense strand, a should be greater than b (e.g. site(20,10)).
NOTE: The site label allows to use relative positions in the feature generation step (step 2).
The position a is considered to be 1. That means the interval -5 to -1 refers the 5 nuleotides upstream of the specified subsequence.
Example
>Sequence1 site(10,15) class(A)
tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttca
>Sequence2 site(15,25) class(B)
aggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctg
>Sequence2 site(15,10) class(A)
caactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgg
DEMO: Since you have chosen demo 1, the form below is already filled with sequences. This demo shows the application of BioBayesNet in the field of transcription factor binding sites. The corresponding dataset consists of 122 Sp1 binding sites and 390 background sequences. The following pages will also have prefilled forms, but you are able to change parameters if you like. The site is working as in the non-demo-case.